Top » Catalog » SNPs » PF6748

$18.00

PF6748
[PF6748]

PF6748
hg38 Position: ChrY:12454920..12454920
Ancestral: A
Derived: T
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: E1b1b1b2a1a1a1a1f~
Comments: Extracted from genome study of Sardinian samples. Below PF6751.
Forward Primer: PF6748_F AAATTAGCCAGGCACAGTGG
Reverse Primer: PF6748_R CTTTTGGGTGGTGGTTATGC
Reviews

Customers who bought this product also purchased
Y29061
Y29061
Y2933
Y2933
Y4971
Y4971
CTS6837
CTS6837
Y2947
Y2947
FGC64000
FGC64000
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies