Top » Catalog » SNPs » S9747

$18.00

S9747
[S9747]

S9747
hg38 Position: ChrY:7163369..7163369
Ancestral: C
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: E1b1b1b2a1a1a1a1f1a~
Comments: Below S21355
Forward Primer: S9747_F ACACTGCTCAGGTGACAGGC
Reverse Primer: S9747_R AAGACTAGAACCTTCCCAGCATG
Reviews

Customers who bought this product also purchased
FGC64007
FGC64007
FGC64000
FGC64000
FGC32463
FGC32463
Z21434
Z21434
FT60362
FT60362
M81
M81
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies