Top » Catalog » SNPs » Y16780

$18.00

Y16780
[Y16780]

Y16780
hg38 Position: ChrY:12422439..12422439
Ancestral: A
Derived: G
Reference: YFull (2015)
ISOGG Haplogroup: E1b1b1b2a1a1a1a1f1b1
Comments: Below Z21040. Aka BY1098
Forward Primer: Y16780_F AATGGAGGAGTGACTGTGTGG
Reverse Primer: Y16780_R CATATACGAATTCGCTTAGTTACTCG
Reviews

Customers who bought this product also purchased
FT60362
FT60362
Y163601
Y163601
FGC64007
FGC64007
FGC64000
FGC64000
Y6172
Y6172
BY10985
BY10985
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies