Top » Catalog » SNPs » A16980

$18.00

A16980
[A16980]

A16980
hg38 Position: ChrY:15295235..15295235
Ancestral: G
Derived: A
Reference: YSEQ (2017)
ISOGG Haplogroup: J1
Comments: ZS5809 > ZS11614
Forward Primer: A16980_F GGGGCTTTATAATATATAGTATTATTATAGTGACC
Reverse Primer: A16980_R CATACTTTACATATACTATCTAGAGTATATCCACAG
Reviews

Customers who bought this product also purchased
A27225
A27225
WGS400
WGS400
FGC5
FGC5
ZS5809
ZS5809
FGC23914
FGC23914
J1-M267 Superclade Panel
J1-M267 Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies