Top » Catalog » SNPs » A16986

$18.00

A16986
[A16986]

A16986
HG19 Position: ChrY:15299404..15299404
Ancestral: A
Derived: C
Reference: YSEQ (2017)
ISOGG Haplogroup: R1b
Comments: Downstream S1026 > Z16886 > Z16891
Forward Primer: A16986_F CCTCTCCTCCAAAGGGCTG
Reverse Primer: A16986_R TTAACATGTTTTCCTTCATTTCCC
Reviews

Customers who bought this product also purchased
DYS390
DYS390
YSEQ-Alpha
YSEQ-Alpha
DNA Sample Kit
DNA Sample Kit
Whole Genome Sequence (15x)
Whole Genome Sequence (15x)
A16987
A16987
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies