Top » Catalog » SNPs » A16986

$18.00

A16986
[A16986]

A16986
HG19 Position: ChrY:15299404..15299404
Ancestral: A
Derived: C
Reference: YSEQ (2017)
ISOGG Haplogroup: R1b
Comments: Downstream S1026 > Z16886 > Z16891
Forward Primer: A16986_F CCTCTCCTCCAAAGGGCTG
Reverse Primer: A16986_R TTAACATGTTTTCCTTCATTTCCC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
Whole Genome Sequence
Whole Genome Sequence
A16987
A16987
DYS390
DYS390
YSEQ-Alpha
YSEQ-Alpha
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies