Top » Catalog » SNPs » A16987

$18.00

A16987
[A16987]

A16987
hg38 Position: ChrY:11837966..11837966
Ancestral: A
Derived: G
Reference: YSEQ (2017)
ISOGG Haplogroup: R1b
Comments: Downstream S1026 > Z16886 > Z16891
Forward Primer: A16987_F CAACACTTTGGGAAGCCG
Reverse Primer: A16987_R GCAACATTCTCTTTGGGGTC
Reviews

Customers who bought this product also purchased
DYS390
DYS390
YSEQ-Alpha
YSEQ-Alpha
DNA Sample Kit
DNA Sample Kit
Whole Genome Sequence
Whole Genome Sequence
A16986
A16986
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies