Top » Catalog » SNPs » A16987

$18.00

A16987
[A16987]

A16987
HG19 Position: ChrY:11837966..11837966
Ancestral: A
Derived: G
Reference: YSEQ (2017)
ISOGG Haplogroup: R1b
Comments: Downstream S1026 > Z16886 > Z16891
Forward Primer: A16987_F CAACACTTTGGGAAGCCG
Reverse Primer: A16987_R GCAACATTCTCTTTGGGGTC
Reviews

Customers who bought this product also purchased
A16986
A16986
DYS390
DYS390
YSEQ-Alpha
YSEQ-Alpha
DNA Sample Kit
DNA Sample Kit
Whole Genome Sequence
Whole Genome Sequence
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies