Top » Catalog » SNPs » Z5010

$18.00

Z5010
[Z5010]

Z5010
hg38 Position: ChrY:6865915..6865915
Ancestral: G
Derived: T
Reference: Greg Magoon et al.
ISOGG Haplogroup: E1b1b1b1a1 (not listed)
Comments: Downstream M183
Forward Primer: Z5010_F GAAGTACACAACCAGTATTCCATATCC
Reverse Primer: Z5010_R GAGACAGGAACTGAAGTAAACACTTTAG
Reviews

Customers who bought this product also purchased
ALK777
ALK777
MZ278
MZ278
BY9626
BY9626
Z36193
Z36193
Y20079
Y20079
P177
P177
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies