Top » Catalog » SNPs » A17064

$18.00

A17064
[A17064]

A17064
hg38 Position: ChrY:15729304..15729304
Ancestral: G
Derived: A
Reference: David Nicolson (2017)
ISOGG Haplogroup: I2
Comments: Below BY3099
Forward Primer: A17064_F GCCATGGTCATTGATATTTGG
Reverse Primer: A17064_R TGAATGGCCACAAAGAACAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies