Top » Catalog » SNPs » CTS6433

$18.00

CTS6433
[CTS6433]

CTS6433
hg38 Position: ChrY:14778084..14778084
Ancestral: T
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: I2a2a1b2a2
Comments: Syn. with CTS6433; downstream CTS2392 Z76
Forward Primer: CTS6433v2_F CCCAACTACTTGAGAGGCTAAGC
Reverse Primer: CTS6433v2_R ACTATGGAGGAACTCCTGAGGG
Reviews

Customers who bought this product also purchased
Y110378
Y110378
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
Y6639
Y6639
M253
M253
CTS10743
CTS10743
Y61120
Y61120
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies