Top » Catalog » SNPs » S2361

$18.00

S2361
[S2361]

S2361
hg38 Position: ChrY:15243365..15243365
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I2a2a1b2a2a1
Comments: Below L801 > S2364, syn with Z167.
Forward Primer: S2361_F GAATGTGAATCAGCAGGTGAC
Reverse Primer: S2361_R ATATTGCCCAGGCTGTTGTG
Reviews

Customers who bought this product also purchased
Y110378
Y110378
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
Y6639
Y6639
M253
M253
CTS10743
CTS10743
Y61120
Y61120
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies