Top » Catalog » SNPs » A17271

$18.00

A17271
[A17271]

A17271
hg38 Position: ChrY:15214085..15214085
Ancestral: C
Derived: T
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: Below PF4088
Forward Primer: A17271_F TTGTGATGGGAATTGGGTTC
Reverse Primer: A17271_R AAACATCGCCTTCTCTGAGC
Reviews

Customers who bought this product also purchased
HVR1
HVR1
PF4125
PF4125
Y23411
Y23411
BY130413
BY130413
Y24017
Y24017
Z27030
Z27030
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies