Top » Catalog » SNPs » A17271

$18.00

A17271
[A17271]

A17271
hg38 Position: ChrY:15214085..15214085
Ancestral: C
Derived: T
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: Below PF4088
Forward Primer: A17271_F TTGTGATGGGAATTGGGTTC
Reverse Primer: A17271_R AAACATCGCCTTCTCTGAGC
Reviews

Customers who bought this product also purchased
HVR1
HVR1
Z27030
Z27030
A19455
A19455
Z27034
Z27034
Y84185
Y84185
CTS4720
CTS4720
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies