Top » Catalog » SNPs » A17355

$18.00

A17355
[A17355]

A17355
hg38 Position: ChrY:7009283..7009283
Ancestral: A
Derived: G
Reference: Igor Schein (2017)
ISOGG Haplogroup: E1b
Comments: Downstream M84 > Y5441 > Y5427 > Y14899 > Y14891 > Y16781 > Y18621
Forward Primer: A17355_F ATGAGCATAAAACAGCGTCG
Reverse Primer: A17355_R TATAGAATTCAGTTAATTTTCCTCTCACG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies