Top » Catalog » SNPs » PF2028

$18.00

PF2028
[PF2028]

PF2028
hg38 Position: ChrY:7766826..7766826
Ancestral: G
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: E (not listed)
Comments: Extracted from genome study of Sardinian samples. Also reported in R1b-M222/S7814
Forward Primer: PF2028_F CTTTCAGGAGCCACCAGTTC
Reverse Primer: PF2028_R TGGCTACACTGACCCATCTG
Reviews

Customers who bought this product also purchased
A694
A694
BY205
BY205
FGC29785
FGC29785
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies