Top » Catalog » SNPs » A822

$18.00

A822
[A822]

A822
hg38 Position: ChrY:13223787..13223787
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Downstream A223
Forward Primer: A822_F TGCACTTGTATGCCCTAAACC
Reverse Primer: A822_R CTGGGATTACAGCTGCATGG
Reviews

Customers who bought this product also purchased
DF13
DF13
Z39589
Z39589
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
BY18130
BY18130
FGC23742
FGC23742
BY11697
BY11697
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies