Top » Catalog » SNPs » A822

$18.00

A822
[A822]

A822
hg38 Position: ChrY:13223787..13223787
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Downstream A223
Forward Primer: A822_F TGCACTTGTATGCCCTAAACC
Reverse Primer: A822_R CTGGGATTACAGCTGCATGG
Reviews

Customers who bought this product also purchased
A984
A984
A10528
A10528
ZS8379
ZS8379
BY18130
BY18130
FGC23742
FGC23742
DF13
DF13
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies