Top » Catalog » SNPs » PH1237

$18.00

PH1237
[PH1237]

PH1237
hg38 Position: ChrY:12327761..12327761
Ancestral: C
Derived: T
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: I2a2b2 (not listed)
Comments: Below S2606.
Forward Primer: PH1237_F TTATTTGTTTGAGCAGCAATAAATAGG
Reverse Primer: PH1237_R ACGCACTGGCTGTTTTGG
Reviews

Customers who bought this product also purchased
S2606
S2606
BY111953
BY111953
I2 Superclade Panel
I2 Superclade Panel
Y177575
Y177575
M253
M253
A577
A577
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies