Top » Catalog » SNPs » S2606

$18.00

S2606
[S2606]

S2606
hg38 Position: ChrY:20365516..20365516
Ancestral: C
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I2a2b2
Comments: Below L38, parallel to BY14072
Forward Primer: S2606_F GTTGTGGTCCATGCCTGTAG
Reverse Primer: S2606_R TCATTTTTACACCAAAATTTGTCAG
Reviews

Customers who bought this product also purchased
Y177575
Y177575
M253
M253
A577
A577
Z59
Z59
Y125026
Y125026
Z2336
Z2336
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies