Top » Catalog » SNPs » CTS9857

$18.00

CTS9857
[CTS9857]

CTS9857
HG19 Position: ChrY:19103066..19103066
Ancestral: A
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: I1a (not listed)
Comments: Extracted from 1000 genomes data. phyloequivalent DF29
Forward Primer: CTS9857_F AAATCATCATTCTCAGTAAACTATGGG
Reverse Primer: CTS9857_R CCCAGGGTAAAAATAGACACG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies