Top » Catalog » SNPs » A16158

$18.00

A16158
[A16158]

A16158
HG19 Position: ChrY:19295092..19295092
Ancestral: G
Derived: C
Reference: Alex Williamson (2017)
ISOGG Haplogroup: R1b
Comments: Downstream S659
Forward Primer: A16158_F CAGACACGGTGGCTCACTC
Reverse Primer: A16158_R CCCTTTCACAAAGGCATCAC
Reviews

Customers who bought this product also purchased
A16159
A16159
A16157
A16157
A16161
A16161
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies