Top » Catalog » SNPs » A16159

$18.00

A16159
[A16159]

A16159
HG19 Position: ChrY:16249123..16249123
Ancestral: T
Derived: C
Reference: Alex Williamson (2017)
ISOGG Haplogroup: R1b
Comments: Downstream S659
Forward Primer: A16159_F ATCATGTATTCAAGTTGACATGTAAATTC
Reverse Primer: A16159_R GGGTGGTTGTGCCTTCAG
Reviews

Customers who bought this product also purchased
A16157
A16157
A16161
A16161
A16158
A16158
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies