Top » Catalog » SNPs » A16161

$18.00

A16161
[A16161]

A16161
hg38 Position: ChrY:6955712..6955712
Ancestral: T
Derived: C
Reference: Alex Williamson (2017)
ISOGG Haplogroup: R1b
Comments: Downstream S659
Forward Primer: A16161_F CTTTTACTGGTCACTGACTGTCACTG
Reverse Primer: A16161_R GCCACATATTAACAAGAAATTACAAAGG
Reviews

Customers who bought this product also purchased
A16159
A16159
A16158
A16158
A16157
A16157
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies