Top » Catalog » SNPs » A17388

$18.00

A17388
[A17388]

A17388
hg38 Position: ChrY:7784309..7784309
Ancestral: C
Derived: T
Reference: Jef Treece (2017)
ISOGG Haplogroup: R1b
Comments: Below P312 > DF27>BY3291
Forward Primer: A17388_F CACGCTTGTAATTGCAGCAC
Reverse Primer: A17388_R CCCACTTGATCCTCACAACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies