Top » Catalog » SNPs » A17390

$18.00

A17390
[A17390]

A17390
HG19 Position: ChrY:14044618..14044618
Ancestral: C
Derived: T
Reference: Jef Treece (2017)
ISOGG Haplogroup: R1b
Comments: Below P312 > DF27>BY3291
Forward Primer: A17390_F TGTTCCTTCAGCCACACAAG
Reverse Primer: A17390_R AGCACATCTGACAGCCACAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies