Top » Catalog » SNPs » A17392

$18.00

A17392
[A17392]

A17392
HG19 Position: ChrY:14901150..14901150
Ancestral: G
Derived: C
Reference: Jef Treece (2017)
ISOGG Haplogroup: R1b
Comments: Below P312 > DF27>BY3291
Forward Primer: A17392_F GAGGCCACTGACTTGGAAAC
Reverse Primer: A17392_R AGGCTGGTCTTGGACTCTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies