Top » Catalog » SNPs » A17393

$18.00

A17393
[A17393]

A17393
hg38 Position: ChrY:13656367..13656367
Ancestral: T
Derived: G
Reference: Jef Treece (2017)
ISOGG Haplogroup: R1b
Comments: Below P312 > DF27>BY3291
Forward Primer: A17393_F CACTTGGAACTGCCACTCAC
Reverse Primer: A17393_R TCCACTTCACAGCCTTTGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies