Top » Catalog » SNPs » A17404

$18.00

A17404
[A17404]

A17404
HG19 Position: ChrY:14392513..14392513
Ancestral: G
Derived: C
Reference: Jef Treece (2017)
ISOGG Haplogroup: R1b
Comments: Below P312 > DF27>BY3291
Forward Primer: A17404_F TCAGGGACATCTGTGCTTCC
Reverse Primer: A17404_R TGAGGCTGCAGTGAGCTATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies