Top » Catalog » SNPs » CTS2501

$18.00

CTS2501
[CTS2501]

CTS2501
hg38 Position: ChrY:12210678..12210678
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b1a1a2a1a2c1i
Comments: Aka S836; downstream L21
Forward Primer: CTS2501_F CACAGAAATGATCTGAAGATACTGG
Reverse Primer: CTS2501_R ACTGCCCCAGTCAGATTCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies