Top » Catalog » SNPs » A17407

$18.00

A17407
[A17407]

A17407
HG19 Position: ChrY:21413353..21413353
Ancestral: C
Derived: T
Reference: Janet Akaha (2017)
ISOGG Haplogroup: I2
Comments: Below M223 >Y3670>L1229 >3681>Z2059>Z2068 >Y7244>Y29664>P53
Forward Primer: A17407_F GGAGGCACTACAGGGTGAAC
Reverse Primer: A17407_R TAATGCCGGCTACTTTCCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies