Top » Catalog » SNPs » A17416

$18.00

A17416
[A17416]

A17416
hg38 Position: ChrY:14779115..14779115
Ancestral: G
Derived: T
Reference: Janet Akaha (2017)
ISOGG Haplogroup: I2
Comments: Below M223 >Y3670>L1229 >3681>Z2059>Z2068 >Y7244>Y29664>P53
Forward Primer: A17416_F GGCTGGAGTGCAGTTTTGTG
Reverse Primer: A17416_R AAGGTCCCTGGTCAGACTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies