Top » Catalog » SNPs » FGC57184

$18.00

FGC57184
[FGC57184]

FGC57184
HG19 Position: ChrY:7784059..7784059
Ancestral: T
Derived: C
Reference: Full genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: Below ZS8924
Forward Primer: FGC57184_F GGGGCATGTTTCATCTGC
Reverse Primer: FGC57184_R GTACAGAACTCTGTCTGCTTTCTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies