Top » Catalog » SNPs » FGC57185

$18.00

FGC57185
[FGC57185]

FGC57185
HG19 Position: ChrY:8853637..8853637
Ancestral: C
Derived: T
Reference: Full genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: Below ZS8924
Forward Primer: FGC57185_F CCCCAAATGAAACAGAATGG
Reverse Primer: FGC57185_R ACAAGGCCATGGGAAAAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies