Top » Catalog » SNPs » Z171

$18.00

Z171
[Z171]

Z171
hg38 Position: ChrY:14882122..14882122
Ancestral: G
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: I2a2a1b2a2a1a (not listed)
Comments: I-M223. below S2361. parallel to M284. M379. P78. P95. Y9161. between approx. Z77 and approx. Z78
Forward Primer: Z171_F GGGTCAAATGATATTTCCGGC
Reverse Primer: Z171_R AGGGATAGCATTAGGAGATATACC
Reviews

Customers who bought this product also purchased
FGC3618
FGC3618
CTS6433
CTS6433
BY40104
BY40104
Z161
Z161
BY155974
BY155974
I2a-CTS10100 Panel
I2a-CTS10100 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies