Top » Catalog » SNPs » Y6207

$18.00

Y6207
[Y6207]

Y6207
hg38 Position: ChrY:9560259..9560259
Ancestral: C
Derived: T
Reference: YFull (2014)
ISOGG Haplogroup: I1a1b1 (not listed)
Comments: Downstream of P109 > S7660> S14887 > FGC14514
Forward Primer: Y6207_F TGATGAGCATATACATATGCTATGTAAATG
Reverse Primer: Y6207_R AGGCTGGAGTGCAGTAGTGAG
Reviews

Customers who bought this product also purchased
Y6206
Y6206
Y6212
Y6212
Y6205
Y6205
Y6211
Y6211
I1-Y3663 Bottleneck at FGC14500 Panel.
I1-Y3663 Bottleneck at FGC14500 Panel.
Y6210
Y6210
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies