Top » Catalog » SNPs » Y6207

$18.00

Y6207
[Y6207]

Y6207
hg38 Position: ChrY:9560259..9560259
Ancestral: C
Derived: T
Reference: YFull (2014)
ISOGG Haplogroup: I1a1b1 (not listed)
Comments: Downstream of P109 > S7660> S14887 > FGC14514
Forward Primer: Y6207_F TGATGAGCATATACATATGCTATGTAAATG
Reverse Primer: Y6207_R AGGCTGGAGTGCAGTAGTGAG
Reviews

Customers who bought this product also purchased
Y6209
Y6209
FGC14501
FGC14501
Y6208
Y6208
Y7092
Y7092
Y6206
Y6206
Y6212
Y6212
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies