Top » Catalog » SNPs » Y4760

$18.00

Y4760
[Y4760]

Y4760
hg38 Position: ChrY:12914033..12914033
Ancestral: A
Derived: T
Reference: Yfull (2014)
ISOGG Haplogroup: I2a2a1a2a1a1c1
Comments: Below Y4761.
Forward Primer: Y4760_F TGTGCCCAAACAGGTAAGC
Reverse Primer: Y4760_R CAGGGGTCAGTGAACTTTCTG
Reviews

Customers who bought this product also purchased
Y4731
Y4731
M284
M284
Y5319
Y5319
CTS10100
CTS10100
Y4332
Y4332
Y44043
Y44043
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies