Top » Catalog » SNPs » Y4760

$18.00

Y4760
[Y4760]

Y4760
hg38 Position: ChrY:12914033..12914033
Ancestral: A
Derived: T
Reference: Yfull (2014)
ISOGG Haplogroup: I2a2a1a2a1a1c1
Comments: Below Y4761.
Forward Primer: Y4760_F TGTGCCCAAACAGGTAAGC
Reverse Primer: Y4760_R CAGGGGTCAGTGAACTTTCTG
Reviews

Customers who bought this product also purchased
CTS616
CTS616
FGC57449
FGC57449
Z2079
Z2079
Y4731
Y4731
M284
M284
Y5319
Y5319
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies