Top » Catalog » SNPs » FGC14508

$18.00

FGC14508
[FGC14508]

FGC14508
hg38 Position: ChrY:16274459..16274459
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: I1a1b1 (not listed)
Comments: Downstream of P109 > S7660> S14887. Aka Y3663
Forward Primer: FGC14508_F GCACCTGGATGCCAAAAC
Reverse Primer: FGC14508_R GTTTAACTCAGGTGTGGTGAATCTAG
Reviews

Customers who bought this product also purchased
FGC22045
FGC22045
Y11203
Y11203
P109
P109
I1-L22 (including P109) Panel
I1-L22 (including P109) Panel
FGC22054
FGC22054
FGC33034
FGC33034
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies