Top » Catalog » SNPs » FGC14508

$18.00

FGC14508
[FGC14508]

FGC14508
hg38 Position: ChrY:16274459..16274459
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: I1a1b1 (not listed)
Comments: Downstream of P109 > S7660> S14887. Aka Y3663
Forward Primer: FGC14508_F GCACCTGGATGCCAAAAC
Reverse Primer: FGC14508_R GTTTAACTCAGGTGTGGTGAATCTAG
Reviews

Customers who bought this product also purchased
S244
S244
DF29
DF29
P40
P40
Y29631
Y29631
P38
P38
FGC14188
FGC14188
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies