Top » Catalog » SNPs » A17455

$18.00

A17455
[A17455]

A17455
hg38 Position: ChrY:3005707..3005707
Ancestral: T
Derived: C
Reference: Connie McKenzie (2017)
ISOGG Haplogroup: I2
Comments: Below Y4751 > Y12714
Forward Primer: A17455_F TTTTGCCAGTGCAGAAACTG
Reverse Primer: A17455_R TGGCTGTTCTTTCCCATACC
Reviews

Customers who bought this product also purchased
A17459
A17459
A17464
A17464
A17458
A17458
A17463
A17463
A17457
A17457
A17462
A17462
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies