Top » Catalog » SNPs » Y31239

$18.00

Y31239
[Y31239]

Y31239
hg38 Position: ChrY:7344473..7344473
Ancestral: C
Derived: T
Reference: YFull (2017)
ISOGG Haplogroup: C2b1a2a
Comments: Aka ZQ7. Below M48
Forward Primer: Y31239_F ACCTGTCTGTCTGGCTATCAAAC
Reverse Primer: Y31239_R GCTCGTTGCCCAGGCTAC
Reviews

Customers who bought this product also purchased
ZQ8
ZQ8
ZQ6
ZQ6
ZQ9
ZQ9
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies