Top » Catalog » SNPs » ZQ8

$18.00

ZQ8
[ZQ8]

ZQ8
hg38 Position: ChrY:13022671..13022671
Ancestral: G
Derived: A
Reference: Nurbol Baimukhanov [ShejireDNA] (2017)
ISOGG Haplogroup: C2b1a2a
Comments: Below M48
Forward Primer: ZQ8_F CTCAGGAATGCTGATGAGTCAC
Reverse Primer: ZQ8_R AGGTCCCCAGTAATGGTTCC
Reviews

Customers who bought this product also purchased
DYS439
DYS439
YSEQ-Alpha
YSEQ-Alpha
ZQ9
ZQ9
ZQ6
ZQ6
Y31239
Y31239
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY35603
1 x BY35646
$36.00
Haplogroup Info
Other products
Currencies