Top » Catalog » SNPs » ZQ9

$18.00

ZQ9
[ZQ9]

ZQ9
hg38 Position: ChrY:19372682..19372682
Ancestral: T
Derived: G
Reference: Nurbol Baimukhanov [ShejireDNA] (2017)
ISOGG Haplogroup: C2b1a2a
Comments: Below M48
Forward Primer: ZQ9_F CATCTAGTTTTTCTTTTGATCTTGCAG
Reverse Primer: ZQ9_R CAACATGGACGCAGCTAGAG
Reviews

Customers who bought this product also purchased
ZQ6
ZQ6
Y31239
Y31239
ZQ8
ZQ8
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies