Top » Catalog » SNPs » MZ217

$19.00

MZ217
[MZ217]

MZ217
hg38 Position: ChrY:8715141..8715141
Ancestral: A
Derived: G
Reference: Hamma Bachir (2017)
ISOGG Haplogroup: E1b (not listed)
Comments: Downstream of PF2546
Forward Primer: MZ217_F GGCTGGGTTTGCAGACATAC
Reverse Primer: MZ217_R GAGAAAGCTTGCTTTGCTGAG
Reviews

Customers who bought this product also purchased
MZ118
MZ118
Y282541
Y282541
Y430387
Y430387
FTB33067
FTB33067
MZ195
MZ195
BY10201
BY10201
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies