Top » Catalog » SNPs » MZ217

$18.00

MZ217
[MZ217]

MZ217
hg38 Position: ChrY:8715141..8715141
Ancestral: A
Derived: G
Reference: Hamma Bachir (2017)
ISOGG Haplogroup: E1b (not listed)
Comments: Downstream of PF2546
Forward Primer: MZ217_F GGCTGGGTTTGCAGACATAC
Reverse Primer: MZ217_R GAGAAAGCTTGCTTTGCTGAG
Reviews

Customers who bought this product also purchased
MZ179
MZ179
MZ223
MZ223
M5043
M5043
Z5009
Z5009
FGC22844
FGC22844
M81
M81
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies