Top » Catalog » SNPs » MZ217

$18.00

MZ217
[MZ217]

MZ217
hg38 Position: ChrY:8715141..8715141
Ancestral: A
Derived: G
Reference: Hamma Bachir (2017)
ISOGG Haplogroup: E1b (not listed)
Comments: Downstream of PF2546
Forward Primer: MZ217_F GGCTGGGTTTGCAGACATAC
Reverse Primer: MZ217_R GAGAAAGCTTGCTTTGCTGAG
Reviews

Customers who bought this product also purchased
MZ179
MZ179
MZ223
MZ223
M81
M81
A930
A930
PF2578
PF2578
E1b-L19 Panel
E1b-L19 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies