Top » Catalog » SNPs » S7660

$18.00

S7660
[S7660]

S7660
hg38 Position: ChrY:20640616..20640616
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I1a1b1 (not listed)
Comments: Downstream P109
Forward Primer: S7660_F TATATTTTTTCCTGATGTTTTGATCATC
Reverse Primer: S7660_R AGCCAAGAACCCTCACAGAG
Reviews

Customers who bought this product also purchased
Y26707
Y26707
L1438
L1438
BY73576
BY73576
Y29086
Y29086
S23679
S23679
Z58
Z58
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies