Top » Catalog » SNPs » S7660

$18.00

S7660
[S7660]

S7660
hg38 Position: ChrY:20640616..20640616
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I1a1b1 (not listed)
Comments: Downstream P109
Forward Primer: S7660_F TATATTTTTTCCTGATGTTTTGATCATC
Reverse Primer: S7660_R AGCCAAGAACCCTCACAGAG
Reviews

Customers who bought this product also purchased
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
FGC14188
FGC14188
S244
S244
DF29
DF29
P40
P40
P38
P38
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies