Top » Catalog » SNPs » FGC5081

$18.00

FGC5081
[FGC5081]

FGC5081
hg38 Position: ChrY:14383143..14383143
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: G2a2b1a1
Comments: Approx or below M3355. Aka S18399.
Forward Primer: FGC5081_F GGAAGCTCGAGTTATGTGTGC
Reverse Primer: FGC5081_R TTTCATTCTGTATTTGGGCAAC
Reviews

Customers who bought this product also purchased
Y24446
Y24446
Y155533
Y155533
S18239
S18239
Y24443
Y24443
FGC5116
FGC5116
Z6354
Z6354
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies