Top » Catalog » SNPs » A642

$18.00

A642
[A642]

A642
hg38 Position: ChrY:21826119..21826119
Ancestral: G
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Aka FGC19629. downstream of CTS6889 / CTS11824
Forward Primer: A642_F AACACGCTGCAGAGCTGC
Reverse Primer: A642_R CAGAACGAAGATGACAGAGGAC
Reviews

Customers who bought this product also purchased
A633
A633
A639
A639
A638
A638
A637
A637
A635
A635
A634
A634
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies