Top » Catalog » SNPs » A17510

$18.00

A17510
[A17510]

A17510
hg38 Position: ChrY:14740123..14740123
Ancestral: G
Derived: T
Reference: Connie McKenzie (2017)
ISOGG Haplogroup: I2
Comments: Below A824 > A5860
Forward Primer: A17510_F CACCAGGGATTGCTTTTCTC
Reverse Primer: A17510_R GCCATCCCTATCCAATCCAG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
A17514
A17514
A17513
A17513
A17512
A17512
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies