Top » Catalog » SNPs » A17512

$18.00

A17512
[A17512]

A17512
hg38 Position: ChrY:8018493..8018493
Ancestral: C
Derived: A
Reference: Connie McKenzie (2017)
ISOGG Haplogroup: R1b
Comments: Below A824 > A5860
Forward Primer: A17512_F GGAAGGGGAACATCACACAC
Reverse Primer: A17512_R GCCCACAGATGACATTTTGAC
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
A17513
A17513
A17510
A17510
A17514
A17514
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies